Detail of EST/Unigene BQ150498 |
Acc. | BQ150498 |
Internal Acc. | NF029H11LF1F1092 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase epsilon chain, chloroplastic OS=Medicago sativa E-value=3e-29; ATP synthase epsilon chain, chloroplastic OS=Panax ginseng E-value=4e-29; ATP synthase epsilon chain, chloroplastic OS=Atropa belladonna E-value=1e-28; ATP synthase epsilon chain, chloroplastic OS=Amborella trichopoda E-value=1e-28; ATP synthase epsilon chain, chloroplastic OS=Spinacia oleracea E-value=1e-28; |
Length | 830 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | TGATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ150498 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.51803.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |