| Detail of EST/Unigene BQ150498 |
| Acc. | BQ150498 |
| Internal Acc. | NF029H11LF1F1092 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase epsilon chain, chloroplastic OS=Medicago sativa E-value=3e-29; ATP synthase epsilon chain, chloroplastic OS=Panax ginseng E-value=4e-29; ATP synthase epsilon chain, chloroplastic OS=Atropa belladonna E-value=1e-28; ATP synthase epsilon chain, chloroplastic OS=Amborella trichopoda E-value=1e-28; ATP synthase epsilon chain, chloroplastic OS=Spinacia oleracea E-value=1e-28; |
| Length | 830 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | TGATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ150498 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.51803.1.S1_s_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |