Detail of EST/Unigene BQ151128 |
Acc. | BQ151128 |
Internal Acc. | NF046C06LF1F1039 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=5e-36; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=3e-35; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=3e-34; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=7e-33; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=6e-32; |
Length | 883 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | BQ151128 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6618.1.S1_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |