| Detail of EST/Unigene BQ151190 |
| Acc. | BQ151190 |
| Internal Acc. | NF048A11LF1F1082 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-42; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=3e-42; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-41; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-40; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=2e-39; |
| Length | 826 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | CTTATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | BQ151190 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8527.1.S1_at
|
| Corresponding NCBI Gene | 841996 |
| Trichome-related Gene from Literature | N/A |