Detail of EST/Unigene BQ151190 |
Acc. | BQ151190 |
Internal Acc. | NF048A11LF1F1082 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-42; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=3e-42; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-41; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-40; RuBisCO large subunit-binding protein subunit beta, chloroplastic (Fragment) OS=Secale cereale E-value=2e-39; |
Length | 826 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTTATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ151190 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8527.1.S1_at
|
Corresponding NCBI Gene | 841996 |
Trichome-related Gene from Literature | N/A |