Detail of EST/Unigene BQ151275 |
Acc. | BQ151275 |
Internal Acc. | NF072D07LF1F1059 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=4e-51; Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=3e-40; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=2e-31; Photosystem I reaction center subunit psaK, chloroplastic OS=Chlamydomonas reinhardtii E-value=7e-14; Beta-galactosidase OS=Shigella sonnei (strain Ss046) E-value=3e-09; |
Length | 849 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | ATGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | BQ151275 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3118.1.S1_at
|
Corresponding NCBI Gene | 839918 |
Trichome-related Gene from Literature | N/A |