| Detail of EST/Unigene BQ151275 |
| Acc. | BQ151275 |
| Internal Acc. | NF072D07LF1F1059 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=4e-51; Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=3e-40; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=2e-31; Photosystem I reaction center subunit psaK, chloroplastic OS=Chlamydomonas reinhardtii E-value=7e-14; Beta-galactosidase OS=Shigella sonnei (strain Ss046) E-value=3e-09; |
| Length | 849 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | ATGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | BQ151275 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3118.1.S1_at
|
| Corresponding NCBI Gene | 839918 |
| Trichome-related Gene from Literature | N/A |