Detail of EST/Unigene BQ151373 |
Acc. | BQ151373 |
Internal Acc. | NF076F05LF1F1044 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=4e-52; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=2e-51; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=5e-51; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-49; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-49; |
Length | 822 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ151373 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37221.1.S1_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |