| Detail of EST/Unigene BQ151373 |
| Acc. | BQ151373 |
| Internal Acc. | NF076F05LF1F1044 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=4e-52; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=2e-51; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=5e-51; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-49; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-49; |
| Length | 822 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ151373 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37221.1.S1_at
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |