| Detail of EST/Unigene BQ151383 |
| Acc. | BQ151383 |
| Internal Acc. | NF076H07LF1F1061 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=4e-27; ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=1e-26; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; ATP synthase gamma chain, chloroplastic OS=Spinacia oleracea E-value=3e-24; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=4e-20; |
| Length | 917 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | CTTTCATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCA |
| EST members of Unigene | BQ151383 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34582.1.S1_at
|
| Corresponding NCBI Gene | 825797 |
| Trichome-related Gene from Literature | N/A |