Detail of EST/Unigene BQ151383 |
Acc. | BQ151383 |
Internal Acc. | NF076H07LF1F1061 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase gamma chain, chloroplastic OS=Nicotiana tabacum E-value=4e-27; ATP synthase gamma chain, chloroplastic OS=Pisum sativum E-value=1e-26; ATP synthase gamma chain 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-25; ATP synthase gamma chain, chloroplastic OS=Spinacia oleracea E-value=3e-24; ATP synthase subunit gamma, chloroplastic OS=Zea mays E-value=4e-20; |
Length | 917 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (1 ESTs); |
Sequence | CTTTCATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCA |
EST members of Unigene | BQ151383 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34582.1.S1_at
|
Corresponding NCBI Gene | 825797 |
Trichome-related Gene from Literature | N/A |