| Detail of EST/Unigene BQ151549 |
| Acc. | BQ151549 |
| Internal Acc. | NF099G12LF1F1097 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=1e-35; Glutamine synthetase cytosolic isozyme 1 OS=Glycine max E-value=4e-35; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=6e-35; Glutamine synthetase PR-1 OS=Phaseolus vulgaris E-value=6e-35; Glutamine synthetase cytosolic isozyme 1 OS=Vitis vinifera E-value=1e-33; |
| Length | 783 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ151549 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2525.1.S1_s_at
|
| Corresponding NCBI Gene | 831519 |
| Trichome-related Gene from Literature | N/A |