Detail of EST/Unigene BQ151725 |
Acc. | BQ151725 |
Internal Acc. | NF023A01IR1F1005 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=2e-32; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=7e-32; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=5e-16; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=7e-12; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=2e-11; |
Length | 511 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | GGAAAGCTTTGGTATGAACCTGATTGGTGGAAATTTGGGGATGAAAAATCGTATTTCCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817068 |
Trichome-related Gene from Literature | N/A |