| Detail of EST/Unigene BQ151737 |
| Acc. | BQ151737 |
| Internal Acc. | NF035G09IR1F1070 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. japonica E-value=2e-07; GDP-mannose 3,5-epimerase 1 OS=Oryza sativa subsp. indica E-value=2e-07; GDP-mannose 3,5-epimerase 2 OS=Oryza sativa subsp. japonica E-value=7e-07; GDP-mannose 3,5-epimerase OS=Arabidopsis thaliana E-value=2e-06; |
| Length | 316 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | TGTTGATGTAACATCCTATGGATCGTCTAAAGTGGTATCGACTCAAGCCCCTGTTCAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833002 |
| Trichome-related Gene from Literature | N/A |