Detail of EST/Unigene BQ151813 |
Acc. | BQ151813 |
Internal Acc. | NF053B09IR1F1076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L21, chloroplastic OS=Spinacia oleracea E-value=1e-20; 50S ribosomal protein L21, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; 50S ribosomal protein L21, mitochondrial OS=Arabidopsis thaliana E-value=7e-09; Probable 39S ribosomal protein L21, mitochondrial OS=Dictyostelium discoideum E-value=2e-07; 50S ribosomal protein L21 OS=Dictyoglomus turgidum (strain Z-1310 / DSM 6724) E-value=4e-07; |
Length | 457 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CTTCTACACTTTCAACTCTCTGTTCTTCTTTCACAACCCATTGCTCAATAAAACCTCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840472 |
Trichome-related Gene from Literature | N/A |