Detail of EST/Unigene BQ152728 |
Acc. | BQ152728 |
Internal Acc. | NF023D03IR1F1030 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=2e-22; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=1e-21; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=1e-21; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=1e-21; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=1e-21; |
Length | 176 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CAAGAACGGCCGATTGGCTATGTTCTCCATGTTTGGTTTCTTTGTTCAAGCCATTGTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |