Detail of EST/Unigene BQ153328 |
Acc. | BQ153328 |
Internal Acc. | NF035A05IR1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=7e-18; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=4e-17; Photosystem I reaction center subunit psaK, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-06; |
Length | 256 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | AAGATTTGGATTGGCTCCATCAGCAAACAGGAAAGCAACAGCAGGACTAAAGCTGGAGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839918 |
Trichome-related Gene from Literature | N/A |