| Detail of EST/Unigene BQ153328 |
| Acc. | BQ153328 |
| Internal Acc. | NF035A05IR1F1035 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=7e-18; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=4e-17; Photosystem I reaction center subunit psaK, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-06; |
| Length | 256 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | AAGATTTGGATTGGCTCCATCAGCAAACAGGAAAGCAACAGCAGGACTAAAGCTGGAGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839918 |
| Trichome-related Gene from Literature | N/A |