| Detail of EST/Unigene BQ153339 |
| Acc. | BQ153339 |
| Internal Acc. | NF035B11IR1F1091 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=3e-55; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=3e-51; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Thioredoxin F-type, chloroplastic OS=Brassica napus E-value=2e-49; Thioredoxin F-type, chloroplastic OS=Mesembryanthemum crystallinum E-value=3e-47; |
| Length | 608 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | CTACGGGCCCCACCGTGACTGTCGGACAAGTTACTGAAGTTAATAAGGACACGTTTTGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831501 |
| Trichome-related Gene from Literature | N/A |