| Detail of EST/Unigene BQ153475 |
| Acc. | BQ153475 |
| Internal Acc. | NF039A10IR1F1072 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(8)-fatty-acid desaturase OS=Borago officinalis E-value=8e-62; Delta(8)-fatty-acid desaturase OS=Helianthus annuus E-value=5e-61; Delta(8)-fatty-acid desaturase OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=1e-17; Delta(8)-fatty-acid desaturase OS=Kluyveromyces lactis E-value=2e-17; Delta(8)-fatty-acid desaturase OS=Lachancea kluyveri (strain ATCC 58438 / CBS 3082 / CCRC 21498 / NBRC 1685 / JCM 7257 / NCYC 543 / NRRL Y-12651) E-value=2e-16; |
| Length | 696 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | CAAACATTTTTGCTCTTGTTTTCGCCATCACGAAATGTTCCTGATAGGCTTTACAACATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
| EC | 1.14.19.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819228 |
| Trichome-related Gene from Literature | N/A |