Detail of EST/Unigene BQ153632 |
Acc. | BQ153632 |
Internal Acc. | NF040F12IR1F1102 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=9e-34; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=2e-23; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-22; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=9e-22; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-21; |
Length | 493 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | AAATCCTCAGCTTTTTTTCCTATCATCATTGCCTACTCAACTTCAAGCTACCAAAGTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843077 |
Trichome-related Gene from Literature | N/A |