| Detail of EST/Unigene BQ153632 |
| Acc. | BQ153632 |
| Internal Acc. | NF040F12IR1F1102 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Lipoxygenase 6, choloroplastic OS=Arabidopsis thaliana E-value=9e-34; Linoleate 13S-lipoxygenase 3-1, chloroplastic OS=Solanum tuberosum E-value=2e-23; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=2e-22; Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=9e-22; Lipoxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-21; |
| Length | 493 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | AAATCCTCAGCTTTTTTTCCTATCATCATTGCCTACTCAACTTCAAGCTACCAAAGTAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843077 |
| Trichome-related Gene from Literature | N/A |