| Detail of EST/Unigene BQ153688 |
| Acc. | BQ153688 |
| Internal Acc. | NF043E02IR1F1018 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=9e-39; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=6e-30; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=4e-16; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=2e-13; Sulfite reductase [ferredoxin] OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-08; |
| Length | 255 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | TTTCATGGACAAGGTGAAGCTTCAAGACCTTGAAACAGTTTTGGAGCCATTGTTTTATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |