Detail of EST/Unigene BQ153723 |
Acc. | BQ153723 |
Internal Acc. | NF043G11IR1F1087 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pleckstrin homology domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-51; PH domain-containing protein DDB_G0274775 OS=Dictyostelium discoideum E-value=2e-11; Pleckstrin homology domain-containing family H member 1 OS=Homo sapiens E-value=7e-11; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=2e-10; Pleckstrin homology domain-containing family H member 1 OS=Danio rerio E-value=4e-10; |
Length | 497 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CCAAGAACCAAACCCATCAGACTACACCGGAATCCAATTCTGGTCAAACCCAGAACGTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817520 |
Trichome-related Gene from Literature | N/A |