| Detail of EST/Unigene BQ153894 |
| Acc. | BQ153894 |
| Internal Acc. | NF048G09IR1F1068 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=5e-51; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=6e-49; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=4e-37; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=5e-37; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-37; |
| Length | 524 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835515 |
| Trichome-related Gene from Literature | N/A |