Detail of EST/Unigene BQ154044 |
Acc. | BQ154044 |
Internal Acc. | NF054G06IR1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=2e-30; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-30; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-29; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=2e-29; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=3e-29; |
Length | 517 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CAAATCCAACAATTTAAGGAGTGGCTCTGTAGTAGCAAAGTATGGTGACAAGAGTGTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |