| Detail of EST/Unigene BQ154064 |
| Acc. | BQ154064 |
| Internal Acc. | NF053F11IR1F1094 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycerate dehydrogenase OS=Cucumis sativus E-value=2e-46; Glyoxylate reductase OS=Thermococcus litoralis E-value=1e-20; Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=2e-20; Glyoxylate reductase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=1e-19; Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=6e-19; |
| Length | 310 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | AATTAGTCTTCATCCTATCTTGGATAAAACCACTTATCATCTAGTCAACAAGGAAAGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+); Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04496 C-terminal binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04496 C-terminal binding protein |
| EC | 1.1.1.79 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843129 |
| Trichome-related Gene from Literature | N/A |