| Detail of EST/Unigene BQ154274 |
| Acc. | BQ154274 |
| Internal Acc. | NF063C03IR1F1022 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-92; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=1e-65; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=2e-35; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=2e-35; 50S ribosomal protein L22, chloroplastic OS=Helianthus annuus E-value=2e-35; |
| Length | 623 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | TCTTCTTCCTTCCTTCCCAATTTCCTCCAATGGCTCTTTCTTTAACCGCCATTAACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |