Detail of EST/Unigene BQ154482 |
Acc. | BQ154482 |
Internal Acc. | NF071C05IR1F1038 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Iron-sulfur assembly protein IscA-like 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-41; Iron-sulfur cluster assembly 2 homolog, mitochondrial OS=Bos taurus E-value=3e-27; Iron-sulfur cluster assembly 2 homolog, mitochondrial OS=Mus musculus E-value=6e-26; Iron-sulfur cluster assembly 2 homolog, mitochondrial OS=Pongo abelii E-value=7e-26; Iron-sulfur cluster assembly 2 homolog, mitochondrial OS=Homo sapiens E-value=7e-26; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | ATCCTGGTAAGACATCAATGGTGTGATTTAGCGAGAGAGATGCAAACATCGCTGTTTCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830270 |
Trichome-related Gene from Literature | N/A |