| Detail of EST/Unigene BQ154727 |
| Acc. | BQ154727 |
| Internal Acc. | NF099G09IR1F1072 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=9e-28; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-27; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=6e-27; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=8e-27; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=8e-27; |
| Length | 303 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | GCAGAGTTGAAGGTCAAGGAACTCAAGAACGGCCGATTGGCTATGTTCTCCATGTTTGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |