| Detail of EST/Unigene BQ154740 |
| Acc. | BQ154740 |
| Internal Acc. | NF099H11IR1F1096 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria pringlei E-value=2e-19; Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria brownii E-value=2e-19; Pyruvate, phosphate dikinase, chloroplastic OS=Flaveria bidentis E-value=5e-19; Pyruvate, phosphate dikinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=5e-19; Pyruvate, phosphate dikinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; |
| Length | 669 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | CACACCCACACGACTCTATTCAAACTTCTTGAAACAACAATAATAAAATACCATTACTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827226 |
| Trichome-related Gene from Literature | N/A |