Detail of EST/Unigene BQ154821 |
Acc. | BQ154821 |
Internal Acc. | NF108E04IR1F1035 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=5e-51; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=7e-49; Chlorophyll a-b binding protein 36, chloroplastic OS=Nicotiana tabacum E-value=4e-37; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=6e-37; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-37; |
Length | 549 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |