Detail of EST/Unigene BQ155421 |
Acc. | BQ155421 |
Internal Acc. | NF080B08IR1F1073 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine aminopeptidase 1D, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=6e-81; Methionine aminopeptidase 1B, chloroplastic OS=Arabidopsis thaliana E-value=1e-52; Methionine aminopeptidase 1C, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=3e-49; Methionine aminopeptidase 1D, mitochondrial OS=Dictyostelium discoideum E-value=2e-46; Methionine aminopeptidase 1D, mitochondrial OS=Homo sapiens E-value=5e-42; |
Length | 673 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | GAAGAGAGCATGGCTATGGCCGCAAGCAGCAGCGTGTCACTGTTGAAGTCTTCTTTCACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829858 |
Trichome-related Gene from Literature | N/A |