Detail of EST/Unigene BQ155422 |
Acc. | BQ155422 |
Internal Acc. | NF080D06IR1F1058 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=7e-58; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=3e-41; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-39; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=4e-39; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=5e-39; |
Length | 511 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CAAAAAAGTAGAAGAAGAAGAAGAAGAAATAATAGTAATGGCAACCACACCTGCTTTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |