Detail of EST/Unigene BQ155697 |
Acc. | BQ155697 |
Internal Acc. | NF083C12IR1F1098 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-60; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=4e-46; 50S ribosomal protein L22, chloroplastic OS=Helianthus annuus E-value=1e-31; 50S ribosomal protein L22, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=4e-31; 50S ribosomal protein L22, chloroplastic OS=Lactuca sativa E-value=8e-31; |
Length | 629 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CAAATACCAATGCCAAAACATTTGATTATANAATTAAGTTGAATATTCAAACAGTTCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |