| Detail of EST/Unigene BQ155697 |
| Acc. | BQ155697 |
| Internal Acc. | NF083C12IR1F1098 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-60; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=4e-46; 50S ribosomal protein L22, chloroplastic OS=Helianthus annuus E-value=1e-31; 50S ribosomal protein L22, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=4e-31; 50S ribosomal protein L22, chloroplastic OS=Lactuca sativa E-value=8e-31; |
| Length | 629 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | CAAATACCAATGCCAAAACATTTGATTATANAATTAAGTTGAATATTCAAACAGTTCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |