Detail of EST/Unigene BQ155983 |
Acc. | BQ155983 |
Internal Acc. | NF087H11IR1F1096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=2e-51; Ferredoxin, chloroplastic OS=Capsicum annuum E-value=8e-38; Ferredoxin-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-37; Ferredoxin-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-37; Ferredoxin-1, chloroplastic OS=Mesembryanthemum crystallinum E-value=7e-37; |
Length | 600 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CAAAAAAGTAGAAGAAGAAGAAGAAGAAATAATAGTAATGGCAACCACACCTGCTTTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837639 |
Trichome-related Gene from Literature | N/A |