| Detail of EST/Unigene BQ156140 |
| Acc. | BQ156140 |
| Internal Acc. | NF089F02IR1F1027 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Arabidopsis thaliana E-value=2e-82; Probable chlorophyll(ide) b reductase NYC1, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-81; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-37; Chlorophyll(ide) b reductase NOL, chloroplastic OS=Arabidopsis thaliana E-value=7e-36; Carbonyl reductase family member 4 OS=Xenopus tropicalis E-value=1e-11; |
| Length | 638 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | CCCTGAGTCTGTGCAAGCAACCTGTCAAAGAGCTTGAGGAAAATCTAAAGGAAGGCATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826942 |
| Trichome-related Gene from Literature | N/A |