Detail of EST/Unigene BQ156143 |
Acc. | BQ156143 |
Internal Acc. | NF089F12IR1F1103 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-1, chloroplastic OS=Nicotiana tabacum E-value=7e-10; Ferritin-3, chloroplastic OS=Glycine max E-value=1e-09; Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-09; Ferritin-4, chloroplastic OS=Glycine max E-value=3e-09; Ferritin-1, chloroplastic OS=Zea mays E-value=4e-09; |
Length | 320 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TTGGTAATAAGGTCTAGTTGCAGACAGAAAGAAAGATTTAAGAAAAACGAACCACCATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820276 |
Trichome-related Gene from Literature | N/A |