Detail of EST/Unigene BQ156539 |
Acc. | BQ156539 |
Internal Acc. | NF094A02IR1F1017 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=9e-20; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=6e-19; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-10; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-10; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=3e-10; |
Length | 290 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | GTTTTGGTAAAGATGAGAAATCATTGAAGGAATTAAAGCTGAAGGAAGTTAAGAATGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842446 |
Trichome-related Gene from Literature | N/A |