Detail of EST/Unigene BQ156624 |
Acc. | BQ156624 |
Internal Acc. | NF094F12IR1F1103 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase 2 (Fragment) OS=Flaveria linearis E-value=8e-44; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=2e-42; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-39; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-39; Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=5e-37; |
Length | 545 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TTAAAGGTGGAGAATATTGTAGTTATTGGACACAGCTGCTGTGGAGGCATAAAGGGGCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831326 |
Trichome-related Gene from Literature | N/A |