| Detail of EST/Unigene BQ156784 |
| Acc. | BQ156784 |
| Internal Acc. | NF097B12IR1F1101 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=4e-28; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=8e-16; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-15; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=2e-15; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=2e-15; |
| Length | 315 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA; |
| Sequence | ATGATCCAGACCAAGCTGCAATTCTTAAAGTGAAGGAAATTAAGAATGGTAGACTTGCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826626 |
| Trichome-related Gene from Literature | N/A |