Detail of EST/Unigene BQ156861 |
Acc. | BQ156861 |
Internal Acc. | NF098B01IR1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=2e-72; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=3e-70; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=2e-56; Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=2e-50; Glutathione S-transferase F13 OS=Arabidopsis thaliana E-value=6e-48; |
Length | 649 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CACTCTTGAATCTTGAATTTGAGCAGAAAACATGGTTGTGAAAGTGTATGGACCAGCCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817636 |
Trichome-related Gene from Literature | N/A |