Detail of EST/Unigene BQ156872 |
Acc. | BQ156872 |
Internal Acc. | NF098B07IR1F1061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heat shock 22 kDa protein, mitochondrial OS=Pisum sativum E-value=9e-30; Heat shock 22 kDa protein, mitochondrial OS=Glycine max E-value=4e-27; 23.6 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=8e-24; 23.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=2e-23; Small heat shock protein, chloroplastic OS=Chenopodium rubrum E-value=1e-21; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TCGACGCGGCTGGGATGCGAAAGAGACAGAGGATTCTCTGCTTCTTCGTTTGGATATGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828623 |
Trichome-related Gene from Literature | N/A |