Detail of EST/Unigene BQ157160 |
Acc. | BQ157160 |
Internal Acc. | NF101F09IR1F1079 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L19, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-10; 39S ribosomal protein L11, mitochondrial OS=Rattus norvegicus E-value=2e-08; 39S ribosomal protein L11, mitochondrial OS=Bos taurus E-value=3e-08; 39S ribosomal protein L11, mitochondrial OS=Homo sapiens E-value=4e-08; 39S ribosomal protein L11, mitochondrial OS=Mus musculus E-value=9e-08; |
Length | 490 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CCCGGCCCGGTCACGTGACCGCCACCTCACTGTCACTTCGGCACGTGTATGAGATCGCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829701 |
Trichome-related Gene from Literature | N/A |