Detail of EST/Unigene BQ157354 |
Acc. | BQ157354 |
Internal Acc. | NF103H11IR1F1096 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=8e-30; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-27; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=2e-24; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=8e-11; Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; |
Length | 359 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | AACCCTTTGAACTTTGCACCAACTTTGGAGGCTAAAGAGAAGGAAATTGCTAATGGGAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823901 |
Trichome-related Gene from Literature | N/A |