Detail of EST/Unigene BQ157401 |
Acc. | BQ157401 |
Internal Acc. | NF104D11IR1F1094 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=6e-13; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=1e-10; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=3e-10; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=9e-10; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=9e-10; |
Length | 371 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | CGATAACAAGTCAAATTTTATTTATAAATACTACTACTAAAAACTTAATGCAATCTACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |