Detail of EST/Unigene BQ157665 |
Acc. | BQ157665 |
Internal Acc. | NF107D01IR1F1014 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=3e-24; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=5e-24; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=8e-24; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=7e-23; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=7e-23; |
Length | 456 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TAACTTTCAAGCCCTCTCGCCAGATTTTCAAATCCAACAATTTAAGGAGTGGCCTCTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |