Detail of EST/Unigene BQ157668 |
Acc. | BQ157668 |
Internal Acc. | NF107D07IR1F1062 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 3-isopropylmalate dehydratase OS=Arabidopsis thaliana E-value=2e-96; 3-isopropylmalate dehydratase large subunit 1 OS=Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938) E-value=5e-34; 3-isopropylmalate dehydratase large subunit 1 OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=1e-32; 3-isopropylmalate dehydratase large subunit 2 OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=1e-31; 3-isopropylmalate dehydratase large subunit 1 OS=Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A) E-value=2e-30; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA; |
Sequence | TGAACCAGTATATAGTGACCANCAAGCAAGATTTCTTTCTGAGTATAGATTTGATGTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
EC | 4.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826975 |
Trichome-related Gene from Literature | N/A |