Detail of EST/Unigene BQ157880 |
Acc. | BQ157880 |
Internal Acc. | NF110E01PL1F1006 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L33, chloroplastic OS=Cicer arietinum E-value=1e-31; 50S ribosomal protein L33, chloroplastic OS=Glycine max E-value=3e-27; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tabacum E-value=2e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tomentosiformis E-value=2e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana sylvestris E-value=2e-26; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ157880 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45618.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |