| Detail of EST/Unigene BQ157880 |
| Acc. | BQ157880 |
| Internal Acc. | NF110E01PL1F1006 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L33, chloroplastic OS=Cicer arietinum E-value=1e-31; 50S ribosomal protein L33, chloroplastic OS=Glycine max E-value=3e-27; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tabacum E-value=2e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana tomentosiformis E-value=2e-26; 50S ribosomal protein L33, chloroplastic OS=Nicotiana sylvestris E-value=2e-26; |
| Length | 774 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ157880 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.45618.1.S1_s_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |