Detail of EST/Unigene BQ157894 |
Acc. | BQ157894 |
Internal Acc. | NF002A09PL1F1065 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=5e-22; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=8e-22; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=8e-22; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=8e-22; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=8e-22; |
Length | 844 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | TTATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ157894 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |