Detail of EST/Unigene BQ157897 |
Acc. | BQ157897 |
Internal Acc. | NF002C02PL1F1006 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-44; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=5e-44; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-44; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=8e-44; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-44; |
Length | 813 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ157897 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |