| Detail of EST/Unigene BQ157897 |
| Acc. | BQ157897 |
| Internal Acc. | NF002C02PL1F1006 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-44; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=5e-44; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-44; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=8e-44; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-44; |
| Length | 813 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | TGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | BQ157897 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37209.1.S1_s_at
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |