Detail of EST/Unigene BQ158012 |
Acc. | BQ158012 |
Internal Acc. | NF014C11PL1F1083 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=3e-25; Oxygen-evolving enhancer protein 2, chloroplastic OS=Cucumis sativus E-value=1e-24; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=5e-24; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=5e-24; Oxygen-evolving enhancer protein 2-2, chloroplastic OS=Nicotiana tabacum E-value=9e-24; |
Length | 806 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | CTTCATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCAC |
EST members of Unigene | BQ158012 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1083.1.S1_at
|
Corresponding NCBI Gene | 817630 |
Trichome-related Gene from Literature | N/A |