| Detail of EST/Unigene BQ158012 |
| Acc. | BQ158012 |
| Internal Acc. | NF014C11PL1F1083 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=3e-25; Oxygen-evolving enhancer protein 2, chloroplastic OS=Cucumis sativus E-value=1e-24; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=5e-24; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=5e-24; Oxygen-evolving enhancer protein 2-2, chloroplastic OS=Nicotiana tabacum E-value=9e-24; |
| Length | 806 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
| Sequence | CTTCATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCAC |
| EST members of Unigene | BQ158012 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1083.1.S1_at
|
| Corresponding NCBI Gene | 817630 |
| Trichome-related Gene from Literature | N/A |