Detail of EST/Unigene BQ158035 |
Acc. | BQ158035 |
Internal Acc. | NF017F04PL1F1032 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Photosystem I reaction center subunit VI, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-26; Photosystem I reaction center subunit VI, chloroplastic OS=Oryza sativa subsp. indica E-value=7e-26; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=1e-25; |
Length | 824 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | BQ158035 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36764.1.S1_at
|
Corresponding NCBI Gene | 820859 |
Trichome-related Gene from Literature | N/A |