Detail of EST/Unigene BQ158046 |
Acc. | BQ158046 |
Internal Acc. | NF018C05PL1F1035 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=1e-25; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=1e-22; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Glycine max E-value=2e-19; Ribulose bisphosphate carboxylase small chain 4, chloroplastic OS=Glycine max E-value=5e-18; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Lactuca sativa E-value=9e-18; |
Length | 1082 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (1 ESTs); |
Sequence | ATTAGGGAGGAAAAGAGGAGGGATATTGTATATTTCCTTTTTGCCCCACTTTTTTTAAGA |
EST members of Unigene | BQ158046 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.19516.1.S1_at
|
Corresponding NCBI Gene | 833830 |
Trichome-related Gene from Literature | N/A |