| Detail of EST/Unigene BQ164805 |
| Acc. | BQ164805 |
| Internal Acc. | EST610674 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana plumbaginifolia E-value=1e-41; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=1e-41; Lichenase OS=Nicotiana plumbaginifolia E-value=4e-41; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform GLB OS=Nicotiana tabacum E-value=4e-41; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana tabacum E-value=4e-41; |
| Length | 705 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_KVKC; |
| Sequence | TCATTTCCTCCTACTTCTCACTTCCACTACTTGCAGATGGCAGTTCCATTGGAGTGAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815130 |
| Trichome-related Gene from Literature | N/A |