Detail of EST/Unigene BQ164837 |
Acc. | BQ164837 |
Internal Acc. | EST610706 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose 6-dehydrogenase OS=Glycine max E-value=0; Probable UDP-glucose 6-dehydrogenase 1 OS=Arabidopsis thaliana E-value=0; Probable UDP-glucose 6-dehydrogenase 2 OS=Arabidopsis thaliana E-value=0; UDP-glucose 6-dehydrogenase OS=Drosophila melanogaster E-value=2e-84; UDP-glucose 6-dehydrogenase OS=Rattus norvegicus E-value=1e-81; |
Length | 705 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC; |
Sequence | CGTTTCATCACTCATCTCTCAAGGTTAATTTAGAAAAGCAAAATGGTGAAGATTTGCTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00012 UDPglucose 6-dehydrogenase |
EC | 1.1.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822594 |
Trichome-related Gene from Literature | N/A |