| Detail of EST/Unigene BQ164854 |
| Acc. | BQ164854 |
| Internal Acc. | EST610723 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Choline/ethanolamine kinase OS=Homo sapiens E-value=2e-28; Choline/ethanolamine kinase OS=Mus musculus E-value=5e-28; Choline/ethanolamine kinase OS=Rattus norvegicus E-value=2e-27; Putative choline kinase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-25; Choline kinase B1 OS=Caenorhabditis elegans E-value=4e-25; |
| Length | 826 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_KVKC; |
| Sequence | AATCAAACGGAAATTCTGGTTTCTATTGATCATTTAATTCATTGAATCAAGATGGCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00866 choline kinase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00866 choline kinase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00894 ethanolamine kinase |
| EC | 2.7.1.32 2.7.1.82 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826564 |
| Trichome-related Gene from Literature | N/A |